EST 217779 is a singleton


Sequence

>217779 (1 EST) Length=391 ACGGGAGTATGAACTAGAGAGTGTGGCCATGACACTGATAGCGGGTATCAGGCTACATTATCGGCGGGAAGGGATGCAGA ACGAAGAGATCGCGACCTTTTGTAGATATNTTTGCAAGTATCTGGAAACCGTGGTCAGTATCTTGTACGCGATACCGTAG TGGTCCAGAAGTTATGCAGAATCTGACGCAAGAGGAACTTGAGGCGTGGCAAATTTCGCAGACTTGGTCCACCACGTTAG TACCCACATTTTTATTGAACACATAGTTAAAAGCGAAGGTATTGGTCTTTACAACGCTCTTGCGGCAAAAACTACTGGTT CCAATATGGCTGCAGATGGCGGCTGCTACTGAATATTCTCAAAAACTTCCCCTGTAATTGGGGTTTTCAAA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 217779: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
217779808601R47714AS3ISB123SLBrugia malayi infective L3 JHU93SL-BmL3


Date: 17:22:26 on Wed 22 Nov 117.