EST 217783 is a singleton


Sequence

>217783 (1 EST) Length=358 GGAATTTGTTAGTGTGGNTGTTAGATTAATTATCAAACACATCTCAACCAGAGTTGCTGCTGAAAAGCGAGATCAATGAG GAGAATTCACATCAGATGCTTCATGGGATACGTCCTGTCTACACAGAGACTAATAAGGGAATATTATATGTGTATATCAG GGTGATGAAGGTCGATGACATGTAGAGCGGGGTATTTACCCAAGTTCGAGACTAATGTTGCTCGTTAGTGATGCGGATAG ATTAATTATCAAACGTTTTTTCATCCCTANCNGTGGTTCTGTCTGTTGATGCACTCACAGCAGATTTGGTCGCTGACAAA GGTGGTGCATTATTTCTTCAAACAGGTACAACAAAGGC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Processing,


Cluster Information for 217783: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
217783808605R47718AS3ISB116SLBrugia malayi infective L3 JHU93SL-BmL3


Date: 0:55:39 on Fri 24 Nov 117.