EST 217786 is a singleton


Sequence

>217786 (1 EST) Length=323 CTTGCACATATTTATTAGAGAAGCTAGGTAAGTACTCGATATCAGCACTAGATATATTGATGAGGATCACGAGTTACAGG TATTAGTAGACATGGCAATTGTGGAATTGAGTGACCAGAATAAGTATAGCAGTCTCTTCACATTGGGGNGAGTTATCACA GTTCAGACTCAGTTGGTGCACCACCTCACATAATACTTAACAAAGCTGGTTTGACCGAACACCTGCGGAATGGGTCATTT TGGGATAACTGCACTATGGTATCCTATCAACAGCGGGTATCGGCTATTGCAGTTTAACTTTGTAGTCTGGTATAGGAGAT ACT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 217786: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
217786808608R47721AS3ISB110SLBrugia malayi infective L3 JHU93SL-BmL3


Date: 4:20:24 on Wed 22 Nov 117.