EST 217787 is a singleton


Sequence

>217787 (1 EST) Length=277 TTATCTCTACATGCAGGTCAATATGGGAATGTTGTGGTAAGTCATCAAGGATAGTTCTCTTGGAGATCGGGCTTTCTCGG GATCTCTTTACTGCACCCACAGCTTTTAATTTTGTAGACTATGCGCCATTATGTCTCGGCATATAGTGCGCATTAGTCTG TCTTTGGACTGACTACGTGCTCATCCTCGCAACCCCGAATTCACCAAGTCTTCGGTTTCAAAATTATCGACAACCCTTGC TCCACAAAGGGGGGGCCGCGCACCCACTCCCCACCTA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 217787: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
217787808609R47722AS3ISB109SLBrugia malayi infective L3 JHU93SL-BmL3


Date: 17:56:58 on Mon 20 Nov 117.