EST 217788 is a singleton


Sequence

>217788 (1 EST) Length=294 CCAGGGCAATCCAGGTCCATTGTGGTTGTTATTTCCTCAAGTGAACTAAGATCAACTGTAGAAAGATGGCTCTTCGTTTA ATCGCAAAAAATATTTTCATTGGGGGGATCTTATTGCAGTGCACCTGAAAAAAAAGACAGGATTAACTAGGTTAATTGTT ATTCAAGTTAATGTCCAAGAATCTGGAAATGGAAAGACGTTCAGCTTGTTCAGATTTTGGAAAATTTCAATAATTATAAA TGTTCAGCTATGAAAATATTGTCAATGTTGTCATTTGCTAAATAAATGATAACT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 217788: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
217788808610R47723AS3ISB153SLBrugia malayi infective L3 JHU93SL-BmL3


Date: 5:12:1 on Sat 18 Nov 117.