EST 217798 is a singleton


Sequence

>217798 (1 EST) Length=156 ATCCAGTCACCCACAATACCAAATTATAATGATAACAAATTAATGGAATCTNTCAGTAATGCAAGAATTTATGTATATCG CGGAGAGAAAATTGCTGGTTTCGAGTTACAGGGAATTCGAATGATATGTTTGCCACAGGTNTGAAATGTTTCTAAA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 217798: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
217798808620R47733SWAMCA112SKBrugia malayi adult male cDNA (SAW94NL-BmAM)


Date: 16:26:25 on Mon 20 Nov 117.