EST 241467 is a singleton


Sequence

>241467 (1 EST) Length=243 GGCGTAAATTTTCACTTCATTGTGCTATCACAGTATTATAGTGATGAAGTAATCGAGAAAGTGAAGAAATTCGGTTGACA AAAATTGATCTTACGTCAATCACTTAAAGACGATCGAGAACGAGAAAGGTAATCAACGACAACGACGAGAACGAGAAAGG TAATCAACGACAACGAGAACGAGAAAGGTAATCAACGACAACGACAACGACGACGACAACAACGACGACAACGAAGAAGA AAG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 241467: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
241467837350R64712AS3ISB265SLBrugia malayi infective L3 JHU93SL-BmL3


Date: 14:15:57 on Sat 18 Nov 117.