EST 2655 is a singleton


Sequence

>2655 (1 EST) Length=250 GCGCCTGCTGCTACCCGTGGATATAGTCGCTATCTCTNAGGCGCCTTCTCCGGCAGTCCGACGGTAACCGCCCGTAACCC GTNATAGCCTACCTAGGTAAAGACCCTAAGTACTAGCATGATAGGTCGCTCAATCGATTGGTGTGCCGGAGGTCAACTTT NCACTGTTTCTCAACTCAGTGAACAATCGATGTATTAGCACCAGAATTACTGCTGTATCCAATAAGACTGAAGTNGCACA AGTAGATNTG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 2655: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
2655267590T024750008C3cbsPfHB3.1, Debopam Chakrabarti


Date: 5:17:22 on Tue 21 Nov 117.