EST 2664 is a singleton


Sequence

>2664 (1 EST) Length=305 CACGAGATATGCTATATGTTTGTAAAACCTATTTATCAAAAATTGTAAACTTTAAAATTGATAAAAAAAATGCACTCATG GGATCAACCTTATCTATAATATGTNGTNCAGAAAAAACCGAAGAAATTGTTAATGCTCTTAAACAAAAAANTGATATAAT CAATTTNGGTGATATCTGTAATGTAGACGTAACACAATTATATCATTTTTTTAAAACGTATGNTATTATCTCAGCATTAA AATTATCTCCTNATAAAGNTAATCTTTTTGGNNATCATCCAANTATGGTAAAATGATGGTAACAT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 2664: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
2664267602T024840073C3cbsPfHB3.1, Debopam Chakrabarti


Date: 13:59:15 on Mon 20 Nov 117.