EST 2666 is a singleton


Sequence

>2666 (1 EST) Length=314 CACGAGAAAAAACAACAATTATATGCTGTTAATTTAAATGGTAGTATTATAGAAAANCATGATTTTCCCGTTAGCGGTAG CGGAAGTATATATATNCAATCATATCTACAAGATAAATATAAAANATTTATGACCAAAAAAGAATGCTTCANTCTAATTT TNACCTGTGTTAAATATGCTATGCATAATGNTAATAGTAGTGGAGGCTTAATTCGTATTGTTAACATAACCAAATCGTTT GTTGAAGAATTTCCTGTTGTAAATNCACAAATGANTTTCCANTATTAANCATTAACGGCATATCTATGTGCAAA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr,


Cluster Information for 2666: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
2666267604T024860075C3cbsPfHB3.1, Debopam Chakrabarti


Date: 0:48:0 on Wed 22 Nov 117.