EST 2671 is a singleton


Sequence

>2671 (1 EST) Length=195 CAAAGTTTATATATAGATAAAGGAACGAAGGGCAATTTTGTAATTTGAGCTATTTCCAATTTATTTAAACAGTCAACTTT TATTAAATNATTTATATGTGCATATTCAGATTTAACATATCCCATACATATAGGTTTTTNCAATACAGGAGAGAAGACAC TACTTGTAATATATCCAATNATTTGTCCTGCATTT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 2671: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
2671267609T024910080C3cbsPfHB3.1, Debopam Chakrabarti


Date: 3:58:52 on Sun 19 Nov 117.