EST 2676 is a singleton


Sequence

>2676 (1 EST) Length=268 CTCGAGTTTTTTTTTTTTTTTTTTTTTTANACGNTTCAAATATTATTTTAANTGAAAACAATTTTTTTTTTAATAATATT GATAAAAGTATTGAAGATATAAAAAACATTTCCTTACAATACAAAAAAAAGGCATTCCTTTCNTNCTTATAAAAAAACAT ATATATCTAAGGTAAGTGGTGTAATCTTCTTAATGTATACTNCAGAAGCTTGTTATTTTTTCCCATCAAAATGTTTCAAA TACTTTTAAAAACGNGAAAAAGGTTTAT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 2676: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
2676267613T024950095C7cbsPfHB3.1, Debopam Chakrabarti


Date: 13:2:27 on Sun 19 Nov 117.