EST 2679 is a singleton


Sequence

>2679 (1 EST) Length=334 CACGAGTCTTTCTTTTCCTTCTAATTTTCCAAATCACCCTCCTCAAATGAAATTNACCCAAGAAATGTGGCATCCCAATG TTTTTCCTGATGGGAGAGTGTGTATAAGTATTTAACACNCCCCAGGTGTCGATATTTATAACGAACAAGAAAAACCAGAA GAAAGGTGGAGACCTATATGGTCAGTTGAAGGTATTCTTGTCAGTGTCATTTCGATGTTAAATGAACCCAATTTAGAATC ACCTGCTAATGTTGATGCAGCGGTGCAATTAAAAAATAATATACATGGNTACAAAAGCAAAGTTAGAGCTTTAGGAAAGN ATGTNTTAATTCCA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 2679: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
2679267616T024980101C3cbsPfHB3.1, Debopam Chakrabarti


Date: 6:9:39 on Fri 24 Nov 117.