EST 2688 is a singleton


Sequence

>2688 (1 EST) Length=176 CACGAGCTTTATTTTAGAAAAAGAAATAAAAGAAATATAATTCTTCTACTATTAAATATATTATAATATGAATTTAAATA AAAAAAAATTAAAGTATTATAAAATAACATTATATATATTATATATATATATAAAATAACACCNTTAAACACNTGAGATA AANAAAAAAANTANGA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 2688: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
2688271361T025070112C3cbsPfHB3.1, Debopam Chakrabarti


Date: 7:34:21 on Sat 18 Nov 117.