EST 2695 is a singleton


Sequence

>2695 (1 EST) Length=350 CACGAGATATAGTCCACGATTTGAAAATTGTAGATAATGATTGGTTACTCCCAAGTTATGAAGAAGATAACAATCCCACA GATATATATGAATATTTACCTAATAGTGAATACACAATTAATGACAAAAATATTTATAATTATGAAGAGGAAGAAGAAGA CGATAATTGCGATGAAGCAATTGATATAAACAATTTCTATATGGAAAATAACCTTATTAAAGAACAAGATCCTGCATCAA TAAATAGTACAAGTTGTTACTCTAAGAATATGTTGCATGATAATCTTATGAAAATACGTACGTATGATGTTAGTNTANCC GTACGGGTNAATATTATCAANCACCTCGGN


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 2695: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
2695271368T025140122C3cbsPfHB3.1, Debopam Chakrabarti


Date: 23:18:52 on Sun 19 Nov 117.