EST 2700 is a singleton


Sequence

>2700 (1 EST) Length=261 GGCACGNGAAGAAGTTTTCAAAGAGTATTCTTCAAAACATGACTGTGGAGTAATACTTATTAATCAACAAATTGCCGATG AAATTAGATATCTAGTTGATTTACATGATAAAATATTACCAACTGTCCTTGAAATACCATCAAAAGATAAACCTTTTGAT CCAAACAAAGATTCTATAATTCAAAGAGTCAAACTCTTTTTTGGAGGAGATATTTCTCATCTATAATAGNTTTATATAAN TNTATATNTATNTATCCTTAT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 2700: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
2700271373T025190128C3cbsPfHB3.1, Debopam Chakrabarti


Date: 0:42:53 on Fri 24 Nov 117.