EST 2707 is a singleton


Sequence

>2707 (1 EST) Length=377 GGCACGAGATCTATCTCTGATATCCCAATTGTAAAACTTCATAATAGTTTTGATAATGTTAAAGAAGAATTTGAGAGTGA AAATCTTGAATATGAACAACATAATGAATCTTATTATAAGCATAGTCCTCTAGAAGATTTACAAGATATAATGAATAATA CATCTATACCTCCCTTAGATGGAAAATATTATGATACCCTTGAACAATGGAATGAAGAAAAAATACAAAATAAATTAGAC AAATTAGATGATATACATTCCAAATTAGATAAGCTTATAATATGGGCACAAATACAAGGAAGTGAAAGGCTTAAANCATA TAGTATGGTATACACCCTTAAGGNGGGTTATTTTAACTCTTTTNTTTAAGGGGNTAT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 2707: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
2707271380T025260137C3cbsPfHB3.1, Debopam Chakrabarti


Date: 12:48:59 on Sat 18 Nov 117.