EST 2708 is a singleton


Sequence

>2708 (1 EST) Length=214 GGAACGAGCTGCNAACCGAGGGTAATGTTAGCATCNGATGTGTAGTCGTTAGGTCTATTGTTGNTGCTNTGGGAACGTAT GANGGTGTAGGAACNCGNTCGTGAACCNGTTTTNTATTATCCTGTTGGTTTTNTNTGTCTTGTGCCTCACGCATTATANA CATCTGTCACATTTTTTTCCCGGGACGTTGTGGAATTTCACCAATGTTTTATNT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 2708: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
2708271381T025270138C3cbsPfHB3.1, Debopam Chakrabarti


Date: 4:17:49 on Thu 23 Nov 117.