EST 2712 is a singleton


Sequence

>2712 (1 EST) Length=331 GGCACGAGGTTTTTTTTTTTTTTTTTTTTTATAATAATTATCATTATTTTATAAATATATAAAAATGGGAAGGAAATCAA CCATTAAGCCAGCCACAGGAATAGCAGTTGGATTTAATAGTGGACATGTTGTAACAAAGNGAAATTTAAAATTACATAAG AAAAAGAAACCATTTTCTAAAAGAAAAGAATTGATAAAAGATGTCCGTTAGNGAAATTACTGGNTTTAGTCCATATGAAA AAAGNNTAATTGANTTGATAAAAATAGGTACATCTGCTTCTACTAAANGAAGGTTTNAAANTTCCGCTAAAAAANAAGTT AGGGNNCCCCT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST, Processing,


Cluster Information for 2712: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
2712271385T025310144C3cbsPfHB3.1, Debopam Chakrabarti


Date: 15:9:28 on Wed 22 Nov 117.