EST 2716 is a singleton


Sequence

>2716 (1 EST) Length=320 GGCACGAGAAGATCATGAAAAAATGGAATATTGTATAAACGAGGAGGAGAAGTTGGCTTTCCAGTTGCTTCTAAGCAAGT TAAATCAGGACACTCATTTTGAGCTGTTTCGTAAATTTAAGAATAAAGCTGTGTGGAAGACACTTGAAGGTGGTGAAATT GAATTGGATGATAAGTTAACGAGAGCGGATGTGTTCAGGGAAATGTATAATTGGTGTAAATTTCAATTGGAAATGAAAAA TAAGCAGAGTGAATTATCCCGACTCAAGAAAGCGATTCATCAAAGGATTCTTACTAATTTTGTNTATAATATATATAATC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 2716: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
2716271389T025350148C3cbsPfHB3.1, Debopam Chakrabarti


Date: 16:26:45 on Mon 20 Nov 117.