EST 2719 is a singleton


Sequence

>2719 (1 EST) Length=232 GGCACGAGATCCAATTAAACAATATCTTAAACACATCACATAAAACTTATTTACAAACTTCTTATTTTTTTCCAAATCCT TATCACAGGAACATTCGGAAGATTTTCCCAAAATTAGTTTATCATATGTACTTAAGTTTTTTTTTTTTATTGAAATAGAA TAGAACCCATTAATATTTCTCATATTTCATTAATGTCACTTTGAAAGAAATGAAAAAAAAAAAAAAANNAAA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 2719: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
2719271392T025380151C3cbsPfHB3.1, Debopam Chakrabarti


Date: 9:58:41 on Fri 24 Nov 117.