EST 2731 is a singleton


Sequence

>2731 (1 EST) Length=247 GGCACGAGATTTATTCATTTTTCATTAAATGTATAAGGCCTTAAAAACGGTATTTAAATTTCCCGTTCTTTTTTTTTCAA CCGAACGAACATTGATTAATTAAAAAAAAAATATATATATATATATATTTTTTTTTTTAAATATAAATTTATAACTATTG ATATTATTNANTNAATTTAATTTTTTTTNCTTTTAACGNTCTGCAAAAATAAAATTATAGGGTCAAGCGCGTACATATCT TTATAAA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr,


Cluster Information for 2731: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
2731271404T025500169C3cbsPfHB3.1, Debopam Chakrabarti


Date: 2:44:52 on Fri 24 Nov 117.