EST 2735 is a singleton


Sequence

>2735 (1 EST) Length=314 GGCACGAGCAATAATCCGTTAAAAATATCCATAAATTTTAACAATATCAATATCGATTCATTAAAACCAACTGAACAGTT AGCTAATGAATGTAATTCTTTATTACCATGTCCTTTAAATATTGCAGAAATTAAAACCTACAATATACACGCAACTCAGA GTTTGGTATTATATCAGCGATTATTTATTCCTGAAATTTACAATGCCCTAAATACCTCAAATATTATGATTANCATAACC AGCGNCCCTGGTTATAATGNGGCAAACTACTNNTTTTGATGTAAAAATTGATTGTGCCAAAACGGNCGGTCATT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 2735: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
2735271408T025540174C3cbsPfHB3.1, Debopam Chakrabarti


Date: 10:48:46 on Tue 21 Nov 117.