EST 2737 is a singleton


Sequence

>2737 (1 EST) Length=347 GGCACGAGGTTCGAATGCATTTTAATATTGATTTAAACGTTTTGAAAAGTAAATATAAGTGTAACAAAATAGTTAATGAT GACAAAGTAAAAAGAGGGATGATCAACAAGGAAAATTATGTACCCATCATTTTTGAAAGTGTTGAAAATTCCACATCAAA AGAAAAAATTATTAATGTGTGCTTATGGGGAATTTCTCCTTTTACTTATGGAAAAATAGAAAAAGACTTTGCTTTGATTA ATGCTAGATTGGAGACCCTACACATAAAAAAATCATTCAGGTTTTTAAAATGATAATCCNTATATATAANTGNCTAAGGA TATACATATCTNTATATCTNTNTCCCG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 2737: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
2737271410T025560187C3cbsPfHB3.1, Debopam Chakrabarti


Date: 18:25:53 on Fri 17 Nov 117.