EST 2739 is a singleton


Sequence

>2739 (1 EST) Length=352 GGCACGAGGTATTCTTTTTTTTTCATATATTTTTGTTTCCCATTATTTTATATAGATATTCAAAAGAAGAAGAAGAAAAA TATTTGCATGGAGAATTATACGAACAACACTCTTATGAACACAGCAATGAAAATTTAAATGTTTATTTACCCGGACAGTC ATATAAATATGTAACTCAACACTCATACGAATATTTACCTGAACAAATGTATAAAGAAAATAATNCCCTTACCGATGAAA ATTTATTATTAAAGAGAATGATAGATCTCGACCATTTAAAAATTAAAAAAGAATCAAATGNACATTCAAAGGTACCATGG GCGACTAAAAANTAGTGTGNAATGNGGTCTTC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 2739: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
2739271412T025580189C3cbsPfHB3.1, Debopam Chakrabarti


Date: 0:45:38 on Wed 22 Nov 117.