EST 2741 is a singleton


Sequence

>2741 (1 EST) Length=341 GGCACGAGAAAATTGGTCAGTTAGAATAATATAATTTTTTCCGTTTTTTTTTTTTTTTTATTAATGTACAAGATATATAA TGTTATATTTTATTTTTTGAAGTATATTTTTTATATTTGAAAAATATGCAAAAAACCTAATTATGAAGAAAATAAAAAAT ATAATTTAAGTAATGTTATATTTAGTAGGTAATAATGAATATATAAGANGANCATATAAGAGATATATAAATCTAAAGAN TAAACACAATGAAAAAAATGTTTTAAGTATTTAATGCTGATGNAGGNTAAAATATCCNATGGGTATTANCAAAACCAGNC AATTTTTTGANTTAGGGTAAA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr,


Cluster Information for 2741: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
2741271414T025600191C3cbsPfHB3.1, Debopam Chakrabarti


Date: 6:9:52 on Fri 24 Nov 117.