EST 2743 is a singleton


Sequence

>2743 (1 EST) Length=270 GGCACGAGAGAGAACTAGTCTCGAGTTTTTTTTTATATATTTGCAGCTTAATGGTTGTTATATATTTTTTATAATATTTT ATAAAAAATAAAAAACAAGATAGNTATAATATGTATGATATTTATGTTATGTGATGATTATATATTAAGANTTAAAATAA TAATTAAAATATATATTTATAGTGGTATATCGTCTGAAATTATAAAAAAATAAATAAATAAATAAAAATCATTTTATACA TATATATATATNTCTCTNTATCTNTNTCAC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 2743: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
2743271416T025620193C3cbsPfHB3.1, Debopam Chakrabarti


Date: 2:25:39 on Wed 22 Nov 117.