EST 2745 is a singleton


Sequence

>2745 (1 EST) Length=429 GCCACGAGTTTTTTTTTTTTTTTTTTTTCTTTATTTTTATTATTCGTCTTTCTCTACTGTTGTAACTTCTGATACATAGN TACCATCAAGAAATTTTCTTATATCTTTATTTCTACACAAAACAGATTGATGTATTAATGCAGCTGTTAAGGATACATTT TCAATATCAGCACCACTAACATAAATTTCATCTTTTACATTTGGTGATTTTCCGATAACAACTCCTGGCAAGGCTTTAAC AAATCTAACACTTTTTTCTCCTAAGTAGTTTCTAATTTCGATTCTTGTGTTATTAATCTACAATATTAGAGTTGGTTGGG GAAAGTGAGCATGTACTAANCCCCAATTTTATAATAAGGACCTTTTTNGGGTACCNCCAGGTAAACCAAATTTTTAAAAA TGGGGNNCAAACCCGGTCCGGGTTCAAGG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 2745: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
2745271418T025640195C3cbsPfHB3.1, Debopam Chakrabarti


Date: 17:18:53 on Thu 23 Nov 117.