EST 2748 is a singleton


Sequence

>2748 (1 EST) Length=388 GGCACGAGGTTTTTTTTTTTTTTTTTTTTTTTTTTAAATTGATATAAATAGAAAGGTTGTGACATTTTTGATCACTTCAA TAAATGNATTTATAATGAAGTTGCTTTATATTTCTTTTTTCCCTCATCATTAACCAAACAACAATGGTCAAGATCTCTGA AAATTTCATTATAGTCTAAACTATAACCAACAACAAAGTGNTCAGGAATTGAGANTCCAACGNAATCAGCTTTAAAACCA TTCCACAAAGGTGTTCTTTTAATAAAAAGCCAAGCGATGGCAACGGTTTTTATTTCAAATTTCTTTAANGTNTTCACAAA ACCTTTACCTAAGGGGTTTACCAGGTATCANTAANTATCTTCAACCAATTTAATTNCCANGGTTTNCC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 2748: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
2748271421T025670198C3cbsPfHB3.1, Debopam Chakrabarti


Date: 15:19:15 on Thu 23 Nov 117.