EST 2753 is a singleton


Sequence

>2753 (1 EST) Length=335 GGCACGAGGATAAAACAAATAATTCAAAGAAAGAGAAAAGAAAAAAAAAAAGTAATCATAATAATCATAATAATAATAAT AATAAAAGNACAGATACTCAAAGAAAAGATACTTTGAATAATATGAAATACAAATATAACAATTTTAAAGTAAACGTTTC GGATTTNAGAGTTAAGGNTTGTAATCATATATCCTTAGCATGTAATAGAANTAATAAATATNTACAAAANNTATTGCAAN TATGTATAACGATTTGAAATATTATTTTTNAAANTTGTTCCTTGGGGTCCTTGTTATGTTTGANTGTGGTGGNAAATGGT TTTTTCCCCCTGGCC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 2753: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
2753271426T025720209C3cbsPfHB3.1, Debopam Chakrabarti


Date: 9:34:10 on Fri 24 Nov 117.