EST 2762 is a singleton


Sequence

>2762 (1 EST) Length=243 GGCACGAGGAGAGAGGGATAGAGATAGAGAAAGAGATCGCAATANAGATAGAGAACATAGAAGAGATAGGGATAGAGACA GAGAAAGGGATCGTAATAGAGACAGAGAAAGAGATCGCAATAGAGATAGAGAAAGAGATCGCAATAGAGATAGAGAACAT AGAAGAGATAGGGATAGAGATAGAGAAAGAGATCGTAATAGGGACAGNGAAAGTGATCGTAATAGAGATAGAGAAAGNGA CCG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 2762: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
2762271435T025810224C3cbsPfHB3.1, Debopam Chakrabarti


Date: 4:19:59 on Thu 23 Nov 117.