EST 276430 is a singleton


Sequence

>276430 (1 EST) Length=470 TGGCGGTACTGGACAGTTTGCTTGCAAAAAAAGAAGATAAATCGAGTGTGCCGTCTTCACCAAATACGAGAAAGAATAAA GGAGGTCGGCCACCAGCTGGGAAGCGAGGCGGTGGAAAAGCCAAGAAAATAAGCAAGTCAGCTCGTGCTGGACTACTGTT TCCTGTAACCAAGTTTCATCGATTGCTTAGGAAAGGTCGCTATGCGAGACAGATCTCTCAGTCCGCAGCTGTTTATTTGA GTGCTGTCATCGAATATCTTTCTGCAGAGATGTTGGAGTTATCCGGGAATGCTTGCCGAGACAATAAACGTCAGCGACTT ATCCCCCGTCACATTGTACTTGCTATGAAGAATGACGAGGAATTGAATCAGTTCTGCTCTCGAGTTACCTGTCCGGGTGA GTGGGTCCTGCATTCGTCCATCCCGCTTTGGTTCGCAAAAGGGGGAAAACTCAAGTACCACTGTCGACCA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST, Processing,


Cluster Information for 276430: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
276430881996H16492AS3ISB280SLBrugia malayi infective L3 JHU93SL-BmL3


Date: 11:53:41 on Fri 24 Nov 117.