EST 276434 is a singleton


Sequence

>276434 (1 EST) Length=412 ATCTTGCTAAGCTCTTTNAAAGAAAGGACGGCCCATTGAAAGGATATGATGTTTTGCAAGGATGTATGCAGAGATGAAGA TCTTGCGCAGTCGTCGATCCTAACGATGTCAGTAGCTGGTTTGCATCCGGCCAGCCACAAGGGAAGGAAATTGAGTGTGG CTGAGTAAGGGAGAAATTCAGATTGCTGGTGCATATCCTTCAGACTGTAGGTTGAAGATGGTCGATCACGGTGGGGGGGC CTGTGTCGCAACGGGGTATCGTATTTTGTGCGTCAACCATCGGCATACAAGCAAATGAATTGCATATGAGGATTTGGGTA CCTCCAGGTCGTTACTCAAATTCATCGATGAAGAAGAACAGTCCGCCCTATCTGCCAAAAATAAAATTGTGCATAGTCGA GAGAGGGAGCCA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 276434: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
276434882000H16496AS3ISB312SLBrugia malayi infective L3 JHU93SL-BmL3


Date: 23:53:57 on Sat 18 Nov 117.