EST 2766 is a singleton


Sequence

>2766 (1 EST) Length=373 GGCACGAGTATATGTATAATATTTATATATATCACTTTTCAAAATATAACTTATATAAATTTTGGATTTCATATTTATAT ATAGATTCATCATTTGTTATATCTGGTGTTTCTAGTATGATAGGAATATTTTTAAAATATTTGGATTTCATAATATATTT AAAAGTATCCATAGTTAATTTCCCTTTTCCAATATTTTCATGTCTATCCAGTCCACTTCCTATATCAGATTTGGAATCAT TTAAATGAACAGCTTTTAAATATTTAACATTAACAGTATCATCAAATTGTTTCATGACGGTATCAAAATGTTCAAAGGGT TTTAAATATTATAACCTGGCAGCGGGAAGGTATGGGCATGTATCCAAGGCAAT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr,


Cluster Information for 2766: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
2766271439T025850228C3cbsPfHB3.1, Debopam Chakrabarti


Date: 14:37:38 on Tue 21 Nov 117.