EST 2770 is a singleton


Sequence

>2770 (1 EST) Length=182 GGCACGAGAAAATATTTTATATACTATAATAAATTATATATAAGGAAATAAAAAAAAAAAAAGTAAATCGTATATTATAT CATTTATTATATTAAGTATAGTCATATAGAATGAATTCTCATCCTTATGCTTGTAATAGAGAAGTTACTTTTAAAGANGA ANCATAACTATTTNATAGATAA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 2770: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
2770271443T025890234C3cbsPfHB3.1, Debopam Chakrabarti


Date: 6:9:9 on Wed 22 Nov 117.