EST 2771 is a singleton


Sequence

>2771 (1 EST) Length=200 GGCACGAGGTTGAACAAATATTCCTTTTGAATTATTTAAAAATGGTGTTTTTACGAAAATAATAAAATGAATAAAATATA ATGCCTTGTACGGATTAGTCTCTACTACATATTGTTATAAATATGAGAATGTGCAATATTTTTTTTTTTTTTTTTTTTAN ATTTAAACAAAAAAATTAATGNAAAATATTACAAGNTTAC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 2771: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
2771271444T025900235C3cbsPfHB3.1, Debopam Chakrabarti


Date: 16:11:36 on Fri 17 Nov 117.