EST 2773 is a singleton


Sequence

>2773 (1 EST) Length=385 GGCACGAGCGGCACGAGCTCGTGCGAATCGGCACGAGTAATATATTAAATTCTTTCCCACCTCCACCTTGGGATGAAAAT GGTCCCTTAAGAATACCTTTGTTAGAAGGATATAAAGATAATGGAATAATAGCTATTGGAAAAATTGAATCGGGGACATT ATATGGTAATAATATGAATTGTACTTTAATGCCGAATAAAGTAAAAGTAAAAGTTATGAATGTTTTTTTGGAAGATGATG AAGTACCATATGCAAAACCTGGAGAGAATGTTCGTGTAAGATTATTTGGTGTTGAAGNAGNTCAAATAAGTAAGGGTTTG TTTTATTGTGATTCAATAAACTTATGTCCAGTTGTTCATTGAATTCATAGGGCCGTGTTCAAATT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 2773: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
2773271446T025920237C3cbsPfHB3.1, Debopam Chakrabarti


Date: 10:59:14 on Tue 21 Nov 117.