EST 2780 is a singleton


Sequence

>2780 (1 EST) Length=313 GGCACGAGAAAAAAATTATACAAAATGATTATATACGNATTATAAATGCTGAAAAAGAATATGTACAAAAATATCACGAA GATAAAATCTTTTTAGATAATATAAAAAATGTTTCTTCGTGTGAACTAATAAAAGNTTGTTCATATTCTGTTTTTTTTTA TAATCTATTTATTAAGGGATTGTATTTAAATAAGCAAAATTTAGAACATGCTACCGAAAAGGANCATATACAAAAAANTA TTTCAAAAAATNTTACAAAAAATGNNCTACATATAACTNAANCATCTGGACATGTGTCAAACATTNCAAANTT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 2780: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
2780271453T025990244C3cbsPfHB3.1, Debopam Chakrabarti


Date: 4:5:13 on Thu 23 Nov 117.