EST 2784 is a singleton


Sequence

>2784 (1 EST) Length=411 GGCACGAGCTTAAAAGGTGGGAATGTTAGCGAGGCACAAGCTGATGAATATTTAAATAAAGCTTTAAATAGATTTAAAAA AATGAAGGATCTTTCAAAATTTTTTAATGATCAAGCAGATAATACGGCCAAATTAAATCTACCAAAATCCTTAAATATTC CAAATGATATATTAAACTATGATGTATATAATAGTAGTAATAATAGAAATGATATTGTTGTTAAAGATGAAGTTACAAAT AAGCAAATTATTTCAAAACGTGGAATAATGAGTGTTTTTGTTCCGTAGTAATAATAATGTAATAAANGGGTTGTGGNTTT TGGTANCAATAATAAGGATTATTTTCCCTCANCCCTTATCCTGTAGCCAGGGTAAGGGTAAAATAATAAGGGGTTTGTAA AATTCCAAGGG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 2784: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
2784271457T026030248C3cbsPfHB3.1, Debopam Chakrabarti


Date: 9:54:29 on Fri 24 Nov 117.