EST 2786 is a singleton


Sequence

>2786 (1 EST) Length=260 GGCACGAGTACCAACAGCTCGTAGTAGAGCATTCGAAGATGATGATATGGATGCTGATAACACAGAAGATGATAAAGATG AAGCTGACGNTGCATCCCAACAAAAATCCCCAGCAATTGATGAATTATAGGGTATATATATATTTATATAANCATATTTT TTTTTTTTTTAACATAAAGGGAAACAAAAAAAAAAAAAAAAAATTTCGTACACCCCACAAATAANTAANTATAANTATAT AANTAANTATNTATNTATCT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 2786: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
2786271459T026050251C3cbsPfHB3.1, Debopam Chakrabarti


Date: 21:44:23 on Sat 18 Nov 117.