EST 2790 is a singleton


Sequence

>2790 (1 EST) Length=368 GGCACGAGATCTTACCAACAGTAGCTATTATTATCATAGTAATCATTATTATAGTAATAATTCTTTATCAAAAAGAGGTA GTTCCAATTTAATAGAAAATTTATTAAGTCATAGTGGGACAAAATCAGATAATTTTCAGTCTTTCAATGAAGCTGAAAAT AATGATGGAAAAGATAATCATACAGAAGAAACAATAATGAATAAGAAAACTTCAAAAGTTAATTTTGAAAATATAAAAGN TTCAAAAGGACAAACCGTTTGATAAANATAAAAAAGCATATAANGNAAATGTAGGNTCCTAACCATAAATCCATGGAACC TAATGGGTNCATCTGNAATACCCTTTTGTTCCGGTGGGGCAACCCAGG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 2790: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
2790271463T026090255C3cbsPfHB3.1, Debopam Chakrabarti


Date: 22:18:45 on Sat 18 Nov 117.