EST 2791 is a singleton


Sequence

>2791 (1 EST) Length=471 GGCACGAGCGGCACGAGAAACAATGCCACATTATCTTATATGGAATTATTTAAAGATAGTTACAAAGCTATATTAACTAT GTTTCTTGTAAACTGGTTAACTTTACAATTATTTCCAGGTGTTGGACACAAAAAATGGCAAGAAAGTCATAATATCTCCG ATTATAATGTTACCATTATTGTNGGTATGTTTCAAGTTTTTNATTTTCTCAGTAGATATCCACCAAATCTTACACATATT AAAATCTTTAAAAATTTTNCTTTCTCTTTAAATAAATTATTGGTTGCCAATTCATTGAGNTTATTATTCCATTCCCNTGG NTTATTTTAAATGCATTGTGTTGGTCCACCCNTTTTTCCAAAAACCATTGTNCAACAATGNGGTATGNAATGGGTATGTA GGTTTNCAAATGGGTTGGGTTAANCCTGGCCCATNCCTNGGATTTGTNAAGGGTTTAAAAAAGCCCNGGGA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 2791: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
2791271464T026100257C3cbsPfHB3.1, Debopam Chakrabarti


Date: 20:10:57 on Sat 18 Nov 117.