EST 2793 is a singleton


Sequence

>2793 (1 EST) Length=181 GGCACGAGATAAAACATATGTACACTTTGATTTATAAATTAAAATAAAAAAAATGAATTCTAAAAATTTGAAAAATTAAA TAAAAAAAAAAAAAAAAAAAAATACNCAAATTTAATCATTTGTAATTAAAANTAANTAAATAAATATATNCATATATCCA TATATATATATNTNTNTCTAT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Processing,


Cluster Information for 2793: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
2793271466T026120259C3cbsPfHB3.1, Debopam Chakrabarti


Date: 15:11:41 on Thu 23 Nov 117.