EST 2795 is a singleton


Sequence

>2795 (1 EST) Length=183 GGCACGAGGTTTCGAGTTTTTTTTTTTTTTTTTTTTTTTTTCTNCTTTTACGAACTTCTTTTCCNGTATTCTTCATTCTG ACTTGTTATAATTTGTATATCCGAAAAAATTTTATAAATAATCAAAATNATCGAAATAATCAATACGTAAATATATATAT ATATATATATATATATATANANA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr,


Cluster Information for 2795: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
2795271468T026140262C3cbsPfHB3.1, Debopam Chakrabarti


Date: 18:7:56 on Fri 17 Nov 117.