EST 2797 is a singleton


Sequence

>2797 (1 EST) Length=283 GGNACGAGAAAAATTCTGNTCAATAATAAAAATATAACACTATGTAATACGTATAAAAGGGGATTTATTCAAGTTCTCTT AAAACATGGTATGAATAGTAAAGGCATACAAAATGGATTCTACAATAATAAATATATATTGAGCGCTCAAAAAAATAGTG CCTTTNTTTCAACTGAAAAAAGTCAAGATCTTAGTTCTTTAAGTAAAGAACAAATAGNAGAAAAAATCTTAACGGGTTCT AAACNAATATTTTACCCCCNGATGTTGAAATAAAATATGATGA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 2797: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
2797271470T026160265C3cbsPfHB3.1, Debopam Chakrabarti


Date: 12:41:32 on Fri 17 Nov 117.