EST 2800 is a singleton


Sequence

>2800 (1 EST) Length=401 GGCACGAGTAATAGTTGTAATCGTAATGATCTTGATTTTAATACTTATAAAAATTACATAATTGAGAAGGAAGGTATTAA TTATTTAGCACCTTCTGATGAAGANGATAATAAAAATAGGCGNGCTNGCCAAAAATATATTTATGATAATGCTGATGTGG GTACTCAAAAAAAAGTATTTGATTTGAAATTAAATATGGGTCCATATTCATGTACTTATACAAGAAATGGAAAATATTTA TTAATGACAGGNGTAAAAGGNCATGTAAGTTTGATAGNTACACATAATTTAGAAAGTTTATGTGAGTTTCANGTTGATGA ANTGATTAGNTGTAATTCCAACCATTCCATAATTTTCAGCCTTTTTCCGGGTAGNCCAAAAACNGGGTATGGATATATCC T


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 2800: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
2800271473T026190272C3cbsPfHB3.1, Debopam Chakrabarti


Date: 16:14:0 on Tue 21 Nov 117.