EST 2802 is a singleton


Sequence

>2802 (1 EST) Length=216 GGCACGAGAAGCTCATATACATAAATATATATATTAAGCTATATATTATATTCTATAAATATTACAAAAACTAATTCATA TCCTATAGCATGTAATTACGGNATGTCCAACATAATACATATATATTCCTAAATATATATAATATAATATNNCCTAANTA ACAATATTATATAATNNTATATTNTNTTCCTAATTTATTAAATAANACAAATNAAA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 2802: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
2802271475T026210275C3cbsPfHB3.1, Debopam Chakrabarti


Date: 12:50:16 on Fri 17 Nov 117.