EST 2807 is a singleton


Sequence

>2807 (1 EST) Length=404 GGCACGNGTACTAAATGATATAATATCGCATGAACAAGTAATATCAACTATTAAAAGATTCGTTCAGAAAGGTGAGTTAC CACATTTACTTTTACATGGTCCCCCAGGNACAGGGAAAACGTCTACGATATTGGCTGTGTGTAAAGAATTATATGGAGAT AAGAGAAGTTCATTTGTTTTAGAATTGAATGCTTCTGATGATAGAGGTATAANCGTTATTCGTGATCAAATANAAACATT TGCTGAATCAAAAAATCATTATACANCATGTGAAAAAACANCTTTAAANTTAATTATTTTTAGATGACGCAGATCATATG ACATATCCTGCTCAAAACCGCTNATGTGNAGGANTTATGGAGNCCTNTGCCTAANAATTGTGCGGTTTTTCGTTTGTNAT GTAA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 2807: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
2807271480T026260285C3cbsPfHB3.1, Debopam Chakrabarti


Date: 9:52:58 on Fri 24 Nov 117.