EST 2810 is a singleton


Sequence

>2810 (1 EST) Length=412 GGCACGAGTTTGAATGATATATATTTTTTTAATAGCATTCGTTTTTGGGGCTTGGAGTACACTTAAAAAATTTTNATATT AACAAGACTAAGTTGTATGAAGGAAAGATTGATGAAGAAATAGATAAGAGGCCAGTTACACCGTGTATATTACCAGACGA AGATGCTCAGGTACGGAGATTTTGGACAAACTGCTTTATAACTGACCCTGATGGTTATGGAATTGAAGTCGTTTTGCAAA ATGNGAGCGNCAAATTAGATAGGATTCGTTTTTTTACTACGTCAACAAAAGATGCTCAAAAGTTTTTATTCCGGGCCATT TTTGGGGAATGCCAGCTTGTTAAAAANTTCCAATAGGTCNATTTTGGGTGGAATTTTCGGANCCCCNNGGNATTTTTTTC CGGGTGGGGATT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 2810: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
2810271483T026290290C3cbsPfHB3.1, Debopam Chakrabarti


Date: 1:3:16 on Tue 21 Nov 117.