EST 281195 is a singleton


Sequence

>281195 (1 EST) Length=267 GCTCTCAAATATGATATGCTCAATATTTATTACTTTATATATCATATTAGTTGNACAAGGAGTCCACGTATGGTTGGTTA TCACCCAGCAGGCCCATGGTCTTGGGTCTATCACCATGACTTCTTGGTATCACCCCTTATCATGNCTTGGGGTCCACTGT CATTTTATCAGCCTCACACCTTATCATCCCTATCAATATGCTGATAATATATCATATGTTTCTTGGACAAAAAGGCGTAC AATATTCAGGTGTTTGCACTCGGCCCA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Processing,


Cluster Information for 281195: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
281195889952H21257AS3ISB186SLBrugia malayi infective L3 JHU93SL-BmL3


Date: 19:14:41 on Wed 22 Nov 117.